• CONTACT
Publicité

QUESTION D'ACTU

Covid-19

"Non, le virus SARS-CoV-2 ne contient pas des morceaux du VIH !"

Le Pr Jean-Michel Claverie, spécialiste de génomique, revient sur les assertions du Pr Luc Montagnier concernant le caractère "fabriqué" du nouveau coronavirus. Il explique simplement pourquoi c’est impossible.

\ Kira Yan/iStock

  • Publié le 20.04.2020 à 11h00
  • |
  • |
  • |
  • |


Par le Pr Jean-Michel Claverie

Dans plusieurs interviews récentes, le Pr Luc Montagnier a déclaré que le SARS-CoV-2 serait un virus manipulé par les Chinois et qui contiendrait de l'ADN de VIH (le virus du SIDA) ! Cette allégation reposerait sur la détection de similarités entre le génome du SARS-CoV-2 et celui du VIH.

Des séquences de « bases » désignées par des lettres

Les « textes » de ces génomes, écrits en une suite de « bases », désignées par des lettres (A, T, G, C), pour les deux virus, sont publiquement accessibles dans les bases de données publiques comme celle du National Institute for Biotechnology Information aux Etats-Unis.

Ces deux génomes, longs de 30.000 lettres (ou bases) pour le SARS-CoV-2 et de 9.200 lettres (ou bases) pour le VIH, codent, entre autres, pour les protéines qui permettent aux virus de se multiplier et de fabriquer les particules virales qui permettent leur dissémination.

Comment détecter une manipulation génétique ?

Grace aux méthodes du génie génétique, il est effectivement possible modifier les « textes » de tous les génomes, soit en modifiant une lettre à la fois, soit en y insérant l’équivalent de « paragraphes » (au moins 300 lettres) qui coderaient pour une protéine.

Pour détecter si une insertion a eu lieu, il s’agit de procéder comme on le ferait pour détecter un plagiat dans un roman : on regarde s’il n’y a pas, par endroit, des similarités un peu trop flagrantes, par exemple un paragraphe quasi-identique dans les deux textes.

Si cette similarité concerne seulement quelques mots, ou une phrase (par exemple une citation), on estimera qu’il n’y a pas eu d’emprunt d’un texte dans un autre. Pour que le plagiat soit caractérisé, il faut que l’étendue cette ressemblance dépasse la longueur communément admise pour une coïncidence entre deux textes écrits dans la même langue.

Comment comparer des génomes ?

La comparaison de deux génomes (pour détecter les éventuels emprunts de gènes de l’un vers l’autre) repose sur le même principe. Comme les génomes sont écrits avec les mêmes lettres ATGC, la détection d’une suite de lettres similaires n’est le signe d’un emprunt (une manipulation génétique) que si celle-ci est plus longue que ce que l’on attend des similarités restreintes qui peuvent être liées au hasard dans deux textes écrits totalement indépendamment.

Des méthodes universellement acceptées permettent :

- d’identifier facilement les zones de plus grande ressemblance entre les génomes du Cov-2 et du VIH

- de démontrer que leurs niveaux de similarité ne dépassent pas ce que l’on attend du hasard, et donc qu’elles ne constituent pas la preuve d’un emprunt (c’est-à-dire d’une insertion ou manipulation effectuée par des chercheurs).

Détection des similarités par calcul statistique.

La plus forte similarité détectée par la comparaison des 30.000 lettres du CoV-2 avec les 9.200 du VIH est une « phrase » de 38 lettres, dont 33 sont identiques, au prix d’une insertion (« - »):

La seconde, moins bonne (28/30) est la suivante :

Un calcul (standard) des probabilités associé à ce type d’analyse nous indique que des zones atteignant ce niveau de similarité sont attendues plus de trois fois au hasard, c’est-à-dire en comparant des séquences de mêmes longueurs et de même composition en A,T,G et C fabriquées par un tirage aléatoire.

Conclusion : ces similarités ne sont en aucun cas inhabituelles, et ne peuvent pas servir d’argument en faveur d’une manipulation génétique qui aurait inséré un bout du génome VIH dans celui de SARS-CoV-2.

Mais une autre démonstration, qui ne fait pas appel à un calcul statistique, est encore plus probante.

Si l’on reprend maintenant le bout de séquence de SARS-CoV-2 qui aurait été emprunté au HIV (selon M. Montagnier) :

ATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTC

et qu’on le cherche dans les textes des génomes d’autres souches de coronavirus bien plus anciennes (et naturellement associés aux chauves-souris), on peut vérifier qu’il est bien présent :

Exemple pour un virus isolé en 2005 (similarité 34/38):

Cette zone de séquence code pour la séquence protéique « CANFNVLFSTVF » (les C, A, N …., lettres symbolisent différents acides aminés) conservée à l’identique dans toutes les souches de coronavirus car elle appartient à l’enzyme qui réplique le génome du virus (RNA polymerase) et dont la fonction lui est essentielle..

Conclusion, cette zone de ressemblance avec le VIH est fortuite, et existait dans la plupart des souches de coronavirus et ce, bien avant l’émergence de la Covid-19.

Dernier argument !

Enfin, si l’on se concentre sur la protéine du SARS-CoV-2 qui est la plus exposée à la surface du virus (la fameuse protéine « spike »), et qui serait donc la cible à privilégier pour faire un vaccin (car elle est la cible des anticorps) : sa comparaison détaillée avec la protéine d’enveloppe du virus VIH (la cible privilégiée pour faire un vaccin contre ce virus), à l’aide des méthodes universellement admises, ne détecte AUCUNE similarité.

Vous aimez cet article ? Abonnez-vous à la newsletter !

EN DIRECT

Publicité

LES MALADIES

J'AI MAL

Bras et mains Bras et mains Tête et cou Torse et haut du dos Jambes et pied

SYMPTÔMES

Publicité